Frequently Asked Questions

View All Answers
Submit a Question

General

  • View answer What is non-B DB?

    • non-B DB is a database that stores candidate non-B DNA structures that are systematically identified from the genomic regions of several mammalian species. non-B DB also allows researchers to intersect non-B DNA information with positions of known variation in the genome to assess the possible disruption of these structures as a function of genotypic variation.

  • View answer What is the goal of non-B DB?

    • Several recent publications have provided significant evidence that non-B DNA structures may play a role in DNA instability and mutagenesis, leading to both DNA rearrangements and increased mutational rates, which are hallmark of cancer. The goal of non-B DB is to accelerate cancer research by helping cancer researchers find therapeutic treatments for several cancer types including but not limited to breast, ovary, glioblastoma, prostrate, etc.

  • View answer What are non-B DNAs?

    • DNA exists in many possible conformations that include the A-DNA, B-DNA, and Z-DNA forms; of these, B-DNA is the most common form found in cells. The DNAs that do not fall into a right-handed Watson-Crick double-helix are known as non-B DNAs and comprise cruciform, triplex, slipped (hairpin) structures, tetraplex (G-quadruplex), left-handed Z-DNA, and others.

  • View answer Which non-B DNA motifs are included in non-B DB?

    • Currently, non-B DB provides the most complete list of alternative DNA motif  predictions available, including Z-DNA motifs, quadruplex forming motifs, inverted repeats, mirror repeats and direct repeats and their associated subsets of cruciforms, triplex and slipped structures, respectively. The database also contains motifs predicted to form static DNA bends, short tandem repeats and homo(purine.pyrimidine) tracts.

  • View answer What are the advantages of non-B DB?

    • Since non-B DB contains information on all the main forms of non-B DNA, it is the most comprehensive database of its kind. Other existing databases cover one type of non-B DNA. In addition to the wider scope of coverage, non-B DB was built upon the most updated genome assembly available as of today (e.g. hg19 (build 38) for human). In addition, non-B DB enables users to perform different types of query and visualize the results using GBrowse 2.0 which allows multiple data sources.

  • View answer What are the search criteria used for locating potential non-B DNA motifs?

    • We have taken the approach of using rather broad and general identification methods based exclusively on sequence features; thus, although subsequent filtering of the sampled data is straightforward because of the flexibility provided by the database, our current criteria are expected to include a subset of both false positive and negative hits. 
       
      Input from the community regarding enhanced algorithms for the detection or scoring of identified motifs is most welcomed and may be incorporated into the system if appropriate. Please feel free to contact us.
      DNA feature Search Criteria Subset of "DNA feature" forming non-B DNA Search criteria for "Subset of DNA feature"Example
      Inverted Repeat 10–100 nt with reverse complement within 100 nt spacer Cruciform_Motif if spacer=0-3 nt Example of a an inverted repeat sequence
      Mirror Repeat 10–100 nt mirrored within 100 nt spacer Triplex_Motif 90% Purine or Pyrimidine and 0–8 nt spacer
      Direct Repeat 10–50 nt repeated within 5 nt spacer Slipped_Motif if spacer=0 nt Example of a direct repeat sequence
      G-Quadruplex Forming Repeats 4 or more G-tracts (3-7 G’s) separated by 1–7 nt spacers; Preference for short spacers with C’s and/or T’s Whole set As per the whole set
      Z-DNA Repeat G followed by Y (C or T) for at least 10 nt; One strand must be alternating Gs Whole set As per the whole set Example of a Z-DNA repeat sequence
      A-Phased Repeats 3 or more A-tracts (3-5 As) 10 nt on center each; Spacers between equal sized A-tracts must contain some non As Whole set As per the whole set Example of a-phased repeat sequence

  • View answer What are the acronyms used in non-B DB?

    • Acronym Description
      A Adenine
      ABCC Advanced Biomedical Computing Center
      APR A-Phased Repeat
      C Cytosine
      CMP composition
      DAS Distributed Annotation System
      DR Direct Repeat
      G Guanine
      GFF General Feature Format
      GQFR G-Quadruplex Forming Repeat
      IR Inverted Repeat
      MB Megabyte
      MR Mirror Repeat
      nBMST non-B DNA Motif Search Tool
      R Purine
      rsrd right strand right direction (in reference to  DNA strand orientation)
      STR Short Tandem Repeat
      T Thymine
      wswd wrong strand wrong direction (in reference to DNA strand orientation)
      Y Pyrimidine
      ZDM Z-DNA Motif

Genomic Database Search Tools

  • View answer What is a GFF format?

    • GFF stands for Generic Feature Format and is used for describing genes and other localized features associated with DNA, RNA and Protein sequences. Click here to learn more about GFF.

  • View answer What is DAS which I keep seeing in the name of databases, e.g. nonbDAS?

    • DAS stands for Distributed Sequence Annotation System. The four DAS available on the non-B DB are as follows:
      DAS Description
      abccDAS This database includes features computed at the ABCC including PuPys, STRs, composition, physical DNA characteristics, gene based synteny blocks (GBSB), etc.
      mappingDAS This database includes features remapped to the reference genome using gmap for other data sources such as RefSeq, Ensembl, MGC, Unigene,miRBase etc.
      ncbiDAS This database includes features derived from the NCBI genomes directories including genes, SNPs, cytogenic markers assembly information, RepeatMasker elements, etc.
      nonbDAS This database ncludes alternative DNA structure predictions, including Z-DNA motifs, g-quadruplex forming motifs, inverted repeats, mirror repeats and direct repeats and their associated subsets of cruciforms, triplex and slipped structures, respectively.

  • View answer Can I download the results?

    • Yes, on your result page, click on "Tab-Delimited File" or "GFF File". This should open up a page which you can save and open in a text editor or Microsoft Excel program.

  • View answer What are non-B feature attributes?

    • A Phased Repeat

      • Composition (Equals, Not Equal To)

        • Text string signifying the number of A, C, G, and T nucleotides in the motif sequence. Values of 0 or greater are allowed for each nucleotide.
        • Example=15A/3C/2G/6T

      • Sequence (Equals, Not Equal To)

        • Text string signifying the exact motif pattern String may consist of lowercase 'a', 't', 'c', and 'g' characters without spaces.
        • Example=aaaaattttcaacaaaatactaggaaa
      • Tracts (Equals, Not Equal To, Greater Than, Less Than)
        • Integer value of 3 or greater signifying the number of consecutive adenine tracts making up the A Phased Repeat.
        • Example=3

      Direct Repeat

      • Spacer(Equals, Not Equal To, Greater Than, Less Than)
        • Integer value of 0 or greater signifying the number of nucleotides in the spacer region of the motif.
        • Example=2
      • Repeat (Equals, Not Equal To, Greater Than, Less Than)
        • Integer value of 10 or greater signifying the number of nucleotides in the repeated portion of motif.
        • Example=10
      • Composition (Equals, Not Equal To)
        • Text string signifying the number of A, C, G, and T nucleotides in the repeat portion of the motif sequence. Values of 0 or greater are allowed for each nucleotide.
        • Example=8A/2C/1G/5T
      • Sequence (Equals, Not Equal To)
        • Text string signifying the exact motif nucleotide sequence. String may consist of lowercase “a”, t”, “c”, and “g” characters without spaces.
        • Example=ttccaaaataattgaataattccaaaataattgaa
      • Subset (Equals, Not Equal To)
        • Integer value or 0 or 1 signifying if the motif meets the requirements for identification as a subset of the main motif type. Motifs with “subset=1” meet this more restrictive criteria and are thought to be likely to be able to form non-B DNA structures in vivo.
        • Example=1

      G Quadruplex Motif

      • Composition (Equals, Not Equal To)
        • Text string signifying the number of A, C, G, and T nucleotides in the motif sequence. Values of 0 or greater are allowed for each nucleotide.
        • Example=6A/1C/18G/1T
      • Sequence (Equals, Not Equal To)
        • Text string signifying the exact motif nucleotide sequence. String may consist of lowercase “a”, t”, “c”, and “g” characters without spaces.
        • Example=gggaggagggaggaaggggggcatggg
      • Islands (Equals, Not Equal To, Greater Than, Less Than)
        • Integer value of 1 or greater signifying the number of uninterrupted stretches of guanines that make up the G Quadruplex motif.
        • Example=4
      • Runs (Equals, Not Equal To, Greater Than, Less Than)
        • Integer value of 4 or greater signifying the number of possible non-adjacent runs of 3 or more guanines making up the G Quadruplex motif.
        • Example=4
      • Max (Equals, Not Equal To, Greater Than, Less Than)
        • Integer value of 3 or larger signifying the maximum guanine run length for which 4 or more consecutive runs can be formed in the motif.
        • Example=3

      Inverted Repeat

      • Spacer(Equals, Not Equal To, Greater Than, Less Than)
        • Integer value of 0 or greater signifying the number of nucleotides in the spacer region of the motif.
        • Example=2
      • Repeat (Equals, Not Equal To, Greater Than, Less Than)
        • Integer value of 6 or greater signifying the number of nucleotides in the repeated portion of motif.
        • Example=6
      • Perms (Equals, Not Equal To, Greater Than, Less Than)
        • Integer value of 1 or greater signifying the number of times one of half of the repeated sequence can be shifted to create multiple matches with the other half.
        • Example=1
      • Minloop (Not relevant, should be removed as an option)
      • Composition (Equals, Not Equal To)
        • Text string signifying the number of A, C, G, and T nucleotides in the repeat portion of the motif sequence. Values of 0 or greater are allowed for each nucleotide.
        • Example=0A/1C/0G/5T
      • Sequence (Equals, Not Equal To)
        • Text string signifying the exact motif nucleotide sequence. String may consist of lowercase “a”, t”, “c”, and “g” characters without spaces.
        • Example=ttctttaaaaagaa
      • Subset (Equals, Not Equal To)
        • Integer value or 0 or 1 signifying if the motif meets the requirements for identification as a subset of the main motif type. Motifs with “subset=1” meet this more restrictive criteria and are thought to be likely to be able to form non-B DNA structures in vivo.
        • Example=1

      Mirror Repeat

      • Spacer(Equals, Not Equal To, Greater Than, Less Than)
        • Integer value of 0 or greater signifying the number of nucleotides in the spacer region of the motif.
        • Example=2
      • Repeat (Equals, Not Equal To, Greater Than, Less Than)
        • Integer value of 10 or greater signifying the number of nucleotides in the repeated portion of motif.
        • Example=10
      • Perms (Equals, Not Equal To, Greater Than, Less Than)
        • Integer value of 1 or greater signifying the number of times one of half of the repeated sequence can be shifted to create multiple matches with the other half.
        • Example=1
      • Minloop (Not relevant, should be removed as an option)
      • Composition (Equals, Not Equal To)
        • Text string signifying the number of A, C, G, and T nucleotides in the repeat portion of the motif sequence. Values of 0 or greater are allowed for each nucleotide.
        • Example=0A/7C/0G/3T
      • Sequence (Equals, Not Equal To)
        • Text string signifying the exact motif nucleotide sequence. String may consist of lowercase “a”, t”, “c”, and “g” characters without spaces.
        • Example=cctcctcctcggcatactcctcatcctcctcctcc
      • Subset (Equals, Not Equal To)
        • Integer value or 0 or 1 signifying if the motif meets the requirements for identification as a subset of the main motif type. Motifs with “subset=1” meet this more restrictive criteria and are thought to be likely to be able to form non-B DNA structures in vivo.
        • Example=1

      Short Tandem Repeat

      • Composition (Equals, Not Equal To)
        • Text string signifying the number of A, C, G, and T nucleotides in the motif sequence. Values of 0 or greater are allowed for each nucleotide.
        • Example=1A/0C/2G/0T
      • Sequence (Equals, Not Equal To)
        • Text string signifying the exact motif pattern String may consist of lowercase “a”, t”, “c”, and “g” characters without spaces.
        • Example=ggaggaggag
      • Length (Equals, Not Equal To, Greater Than, Less Than)
        • Integer value from 1 to 9 signifying the length of the short repeated sequence.
        • Exampe=1
      • Type(Equals, Not Equal To, Greater Than, Less Than)
        • Integer value from 1 to 11representing the properties of odd, RY/YR pattern, symmetric, and complementary sequences encoded by subsequent binary bits for the short repeated sequence. For example, a value of 4 signifies an odd length symmetric repeated sequence (e.g. “ctc”) .
        • Exampe=1

      Z DNA Motif

      • Composition (Equals, Not Equal To)
        • Text string signifying the number of A, C, G, and T nucleotides in the motif sequence. Values of 0 or greater are allowed for each nucleotide.
        • Example=2A/3C/3G/3T
      • Sequence (Equals, Not Equal To)
        • Text string signifying the exact motif pattern String may consist of lowercase “a”, t”, “c”, and “g” characters without spaces.
        • Example=tgtgtgcacaca
      • Subset (being removed from current version)
      • Length (Equals, Not Equal To, Greater Than, Less Than)
        • Integer 10 or greater signifying the length of the Z-DNA motif.
        • Example=10
      • Score (being removed from current version)

Miscellaneous

non-B Motif Search Tool (nBMST)

  • View answer Can I submit a batch of sequences on nBMST?

    • Yes, you can submit a batch of sequences which must be separated by a ">".
      Example:
      >sequence 1
      actgggg
      >sequence 2
      aaaaaaaaagggggggggcccccccccggg
      >sequence 3
      ttgggggcccgggg  
                                                                  

  • View answer How long will my job take?

    • Turnaround time for results will vary depending on the size of the sequence(s), the number and types of the non-B DNA motifs selected, and the computing resources available at the ABCC at the time of submission.
       
      In cases where input sequences are very large and/or multiple motifs are selected, an email address is recommended to avoid waiting on-line. A notification email will be sent when the job is completed.
       
      It should be noted that the algorithms for mirror and inverted repeats are the most computationally intensive, and therefore take more time to complete than the rest of the motifs. Thus, in cases where quick results are desired for large sequences, it is recommended that separate jobs be submitted for these two motif types.

Motifs Visualization

non-B DB v2.0

  • View answer What are the major update done on this version non-B DB v2.0 released in June 2012?

    • (1) We have further enhanced search criteria significantly and optimized the algorithms and re-annotated all the five species, human, mouse, chimp, macaque, and dog from v1.0.
      (2) We have 7 additional species since v1.0 namely arabidopsis thaliana, cow, horse, orangutan, pig, platypus, and rat.
      (3) We have included extensive visualization plots using whole genomic level Circos plots and detailed chromosomal level R plots in addition to the existing PolyBrowse viewer.
      (4) We have consolidated       Search by Feature and Search by Feature Attributes.